Epona Evil Empire Digital Cryptocurrency Dog - Mix of St. Bernard, Golder Retriever, Boxer, Grey Wolf, Poodle, French Bulldog, Pug and Yorkshire Terrier

Achievements

Racer
Epona Evil Empire
My favorite game is Fetch except I never bring the ball back. My bark alone scares birds out of my yard. I pee when I'm excited. I hate having to share my food dish... I want to find a mate who enjoys dog parks as much as I do.
  • Purity 4%
  • Age 43 months
  • Racing Exp 11
  • St. Bernard 18%
  • 6 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 0 0 1
 Best Time15.95 sec
No rank  Racing *** Coins
16.7 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAAGAAACCCCGACCGATGAAGAGAAAACTTA
T
G
A
A
G
A
A
A
C
C
C
C
G
A
C
C
G
A
T
G
A
A
G
A
G
A
A
A
A
C
T
T
A
Genes: B8GLI9B82GF

Composition

St. Bernard
18%
Golder Retriever
18%
Boxer
18%
Grey Wolf
9%
Poodle
9%
French Bulldog
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality -51 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Golder Retriever
Legs Boxer
Front Legs Grey Wolf
Head Poodle
Ears French Bulldog
Snout St. Bernard
Mouth Golder Retriever
Nose Pug
Eyes Boxer
Color Yorkshire Terrier