Bernard Basket Digital Cryptocurrency Dog - Mix of Yorkshire Terrier, Golder Retriever, Dachshund, St. Bernard, Labrador BK, Schnauzer, Husky, Boxer and French Bulldog

Achievements

None
Bernard Basket
Hi, I'm Bernard Basket. I work in The Virtual Machine. As a perfectionist, I have to find just the right 'spot'. I'm going kill that damn Nyan Cat if I can catch it. I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I want someone who can show me a good time; I'll do the same for you.
  • Purity 5%
  • Age 42 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGATTATTATGAGCAAGAATAACAAGAAACCGA
G
G
A
T
T
A
T
T
A
T
G
A
G
C
A
A
G
A
A
T
A
A
C
A
A
G
A
A
A
C
C
G
A
Genes: AFFB68C48G9

Composition

Yorkshire Terrier
18%
Golder Retriever
18%
Dachshund
9%
St. Bernard
9%
Labrador BK
9%
Schnauzer
9%
Husky
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -50 points
Lunar Effect -8 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs St. Bernard
Head Labrador BK
Ears Golder Retriever
Snout Schnauzer
Mouth Husky
Nose Golder Retriever
Eyes Boxer
Color French Bulldog