Barkley Brando Crypto Dog - Mix of Boxer, Golder Retriever, Pug, Labrador BK, Border Collie, Yorkshire Terrier, Labrador, Maltese and Rottweiler

Achievements

None
Barkley Brando
My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm not a fan of sleeping on the floor. This body was made for cuddles! I'll outrun you for the ball if I can...that's just how I roll. You scratch my belly and I'll scratch yours ;)
  • Purity 3%
  • Age 41 months
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACGAAAACAGAGCATACTTAAGACCAACCCAC
A
A
C
G
A
A
A
A
C
A
G
A
G
C
A
T
A
C
T
T
A
A
G
A
C
C
A
A
C
C
C
A
C
Genes: G2G86JF85KH

Composition

Boxer
18%
Golder Retriever
18%
Pug
9%
Labrador BK
9%
Border Collie
9%
Yorkshire Terrier
9%
Labrador
9%
Maltese
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect -2 points

Traits Breakdown

Body Boxer
Tail Pug
Legs Boxer
Front Legs Golder Retriever
Head Labrador BK
Ears Border Collie
Snout Yorkshire Terrier
Mouth Golder Retriever
Nose Labrador
Eyes Maltese
Color Rottweiler