Fang Fuzzy Bitcoin Dog - Mix of Pitbull terrier, Maltese, Rottweiler, Poodle, Boxer, Labrador, Pug, French Bulldog, Beagle and Schnauzer

Achievements

None
Fang Fuzzy
Hola! My name is Fang Fuzzy. I like exploring off leash best. I hate never catching that damn rabbit in my dreams. My favorite sport is catching treats my human throws! My female human wears crotchless undies, but she doesn't like the ones I make for her!
  • Purity 1%
  • Age 39 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCCACGACTCCAACCCATCCGAACGACTAATA
A
C
C
C
A
C
G
A
C
T
C
C
A
A
C
C
C
A
T
C
C
G
A
A
C
G
A
C
T
A
A
T
A
Genes: KHING5N29DC

Composition

Pitbull terrier
18%
Maltese
9%
Rottweiler
9%
Poodle
9%
Boxer
9%
Labrador
9%
Pug
9%
French Bulldog
9%
Beagle
9%
Schnauzer
9%

Current Energy

Vitality -60 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs Poodle
Front Legs Pitbull terrier
Head Boxer
Ears Labrador
Snout Pitbull terrier
Mouth Pug
Nose French Bulldog
Eyes Beagle
Color Schnauzer