Stormy Slick Bitcoin Game Dog - Mix of St. Bernard, Labrador, Schnauzer, Rottweiler, Corgi, Pitbull terrier, Labrador BK and Shiba Inu

Achievements

None
Stormy Slick
I'm Stormy Slick. What do they call you? I live in cyberspace. I hate never catching that damn rabbit in my dreams. I like to work out by digging fresh holes in landscaped yards. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 8%
  • Age 43 months
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAATACACCCATGATGAAGCTCCGCAGTACCA
T
G
A
A
T
A
C
A
C
C
C
A
T
G
A
T
G
A
A
G
C
T
C
C
G
C
A
G
T
A
C
C
A
Genes: BCH5BBON6E5

Composition

St. Bernard
27%
Labrador
18%
Schnauzer
9%
Rottweiler
9%
Corgi
9%
Pitbull terrier
9%
Labrador BK
9%
Shiba Inu
9%

Current Energy

Vitality -25 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Schnauzer
Legs Rottweiler
Front Legs Labrador
Head St. Bernard
Ears St. Bernard
Snout Corgi
Mouth Pitbull terrier
Nose Labrador BK
Eyes Shiba Inu
Color Labrador