Squeakers Shiner Litecoin Dog - Mix of French Bulldog, Beagle, Poodle, German Shepard, Corgi, Maltese, Shiba Inu, Pitbull terrier, Labrador and Boxer

Achievements

Racer
Squeakers Shiner
You can call me Squeakers Shiner, everybody else does. I enjoy destroying a nice fresh pair of slippers. I am not above stealing food off humans' plates. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. My favorite place in the world is the dog park. So many smells!
  • Purity 1%
  • Age 39 months
  • Racing Exp 15
  • French Bulldog 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 1 0
 Best Time16.70 sec
No rank  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGACTCAAGCCGAACCGTACGATCCCCAAAC
C
T
A
G
A
C
T
C
A
A
G
C
C
G
A
A
C
C
G
T
A
C
G
A
T
C
C
C
C
A
A
A
C
Genes: DI7O9KE9N5G

Composition

French Bulldog
18%
Beagle
9%
Poodle
9%
German Shepard
9%
Corgi
9%
Maltese
9%
Shiba Inu
9%
Pitbull terrier
9%
Labrador
9%
Boxer
9%

Current Energy

Vitality -42 points
Lunar Effect +2 points

Traits Breakdown

Body Beagle
Tail Poodle
Legs German Shepard
Front Legs Corgi
Head French Bulldog
Ears Maltese
Snout Shiba Inu
Mouth French Bulldog
Nose Pitbull terrier
Eyes Labrador
Color Boxer