Squeakers Shiner Litecoin Dog - Mix of French Bulldog, Beagle, Poodle, German Shepard, Corgi, Maltese, Shiba Inu, Pitbull terrier, Labrador and Boxer
Squeakers Shiner
  • Purity 1%
  • Age 72 months
  • Racing Exp 15
  • French Bulldog 18%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

You can call me Squeakers Shiner, everybody else does. I enjoy destroying a nice fresh pair of slippers. I am not above stealing food off humans' plates. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. My favorite place in the world is the dog park. So many smells!

Racing Stats

Ran 2 races
  • 1 1 0
 Best Time16.70 sec
No rank  RacingĀ *** Pts
100.0% wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTAGACTCAAGCCGAACCGTACGATCCCCAAAC
C
T
A
G
A
C
T
C
A
A
G
C
C
G
A
A
C
C
G
T
A
C
G
A
T
C
C
C
C
A
A
A
C
Genes: DI7O9KE9N5G

Composition

French Bulldog
18%
Beagle
9%
Poodle
9%
German Shepard
9%
Corgi
9%
Maltese
9%
Shiba Inu
9%
Pitbull terrier
9%
Labrador
9%
Boxer
9%

Current Energy

Vitality -42 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Poodle
Legs German Shepard
Front Legs Corgi
Head French Bulldog
Ears Maltese
Snout Shiba Inu
Mouth French Bulldog
Nose Pitbull terrier
Eyes Labrador
Color Boxer

Parents

No Children

Photos

Litecoin canine racing results Litecoin dog race results cryptocurrency dog racing podium virtual pet race results virtual pet race online doggy racing photo crypto dog race photo virtual dog racing photo
Gift