Gina Genesis Crypto Game Dog - Mix of Corgi, Dachshund, French Bulldog, Schnauzer, Maltese, Yorkshire Terrier, German Shepard and Beagle

Achievements

None
Gina Genesis
I was born in the web cloud. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! When my human brushes my coat, I get frisky! I'm totally against baths! They are the worst! My favorite position is doggie style ;)
  • Purity 6%
  • Age 41 months
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGACGAATAACCAGCTTAAGCGGATCACTAAGC
G
G
A
C
G
A
A
T
A
A
C
C
A
G
C
T
T
A
A
G
C
G
G
A
T
C
A
C
T
A
A
G
C
Genes: A9CKOFOA7DO

Composition

Corgi
27%
Dachshund
18%
French Bulldog
9%
Schnauzer
9%
Maltese
9%
Yorkshire Terrier
9%
German Shepard
9%
Beagle
9%

Current Energy

Vitality -62 points
Lunar Effect -2 points

Traits Breakdown

Body Dachshund
Tail French Bulldog
Legs Schnauzer
Front Legs Maltese
Head Corgi
Ears Yorkshire Terrier
Snout Corgi
Mouth Dachshund
Nose German Shepard
Eyes Beagle
Color Corgi