Gina Genesis

I was born in the web cloud. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! When my human brushes my coat, I get frisky! I'm totally against baths! They are the worst! My favorite position is doggie style ;)

Purity 6%
Age 41 months
Racing Exp 0

Corgi 27%
0 races
Gen 0

Depressed & Snaillike

Energy: ▂▃▅▆▇

Racing Stats

0 0 0


0 races	Best Time	--
No rank	Racing	*** Coins
0.0 % wins (0)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: GGACGAATAACCAGCTTAAGCGGATCACTAAGC

Genes: A9CKOFOA7DO

Composition

Corgi	27%
Dachshund	18%
French Bulldog	9%
Schnauzer	9%
Maltese	9%
Yorkshire Terrier	9%
German Shepard	9%
Beagle	9%

Current Energy

Vitality	-62 points
Lunar Effect	-2 points

Traits Breakdown

Body	Dachshund
Tail	French Bulldog
Legs	Schnauzer
Front Legs	Maltese
Head	Corgi
Ears	Yorkshire Terrier
Snout	Corgi
Mouth	Dachshund
Nose	German Shepard
Eyes	Beagle
Color	Corgi