Monster Man Molly Crypto Dog - Mix of Grey Wolf, Border Collie, German Shepard, Poodle, French Bulldog, Beagle, Shiba Inu, Schnauzer and Pug

Achievements

None
Monster Man Molly
The cloud's my neighborhood. I'm willing to try little bondage, so my human chained me up! Power outages and computer viruses scare me! I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 5%
  • Age 41 months
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCTCATACGACCGACTATACGTAATAGAA
C
C
C
C
C
C
T
C
A
T
A
C
G
A
C
C
G
A
C
T
A
T
A
C
G
T
A
A
T
A
G
A
A
Genes: LL7JI9DJEC2

Composition

Grey Wolf
18%
Border Collie
18%
German Shepard
9%
Poodle
9%
French Bulldog
9%
Beagle
9%
Shiba Inu
9%
Schnauzer
9%
Pug
9%

Current Energy

Vitality -16 points
Lunar Effect -10 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs German Shepard
Front Legs Border Collie
Head Poodle
Ears French Bulldog
Snout Beagle
Mouth Border Collie
Nose Shiba Inu
Eyes Schnauzer
Color Pug