Atta Akuma Litecoin Dog - Mix of Poodle, Rottweiler, Boxer, Maltese, Corgi, Pug, Border Collie and Husky

Achievements

None
Atta Akuma
My name is Atta Akuma and I do tricks. I am a guard dog for the data warehouse. I don't like to be ignored. What's your favorite bed? Mine is the dirty laundry. I am a proud show dog. I like showing off my perfect coat! Once I caught a seagull, but it scared me so I let it go.
  • Purity 11%
  • Age 2 months
  • Racing Exp 0
  • Poodle 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGACAACACCGACGACAGCGACGAATACACA
C
A
C
G
A
C
A
A
C
A
C
C
G
A
C
G
A
C
A
G
C
G
A
C
G
A
A
T
A
C
A
C
A
Genes: HIGKIIOI2J4

Composition

Poodle
36%
Rottweiler
9%
Boxer
9%
Maltese
9%
Corgi
9%
Pug
9%
Border Collie
9%
Husky
9%

Current Energy

Vitality -16 points
Lunar Effect -14 points

Traits Breakdown

Body Rottweiler
Tail Poodle
Legs Boxer
Front Legs Maltese
Head Poodle
Ears Poodle
Snout Corgi
Mouth Poodle
Nose Pug
Eyes Border Collie
Color Husky