Destiny Dylan Bitcoin Dog - Mix of German Shepard, Labrador, Boxer, Rottweiler, Yorkshire Terrier, Pug, Pitbull terrier, Maltese, Corgi and Grey Wolf

Achievements

Racer
Destiny Dylan
How YOU doin'? Destiny Dylan here. I live in cyberspace where you can turn me on. I am not above stealing food off humans' plates. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. If you are looking for companionship without commitment, keep looking.
  • Purity 3%
  • Age 39 months
  • Racing Exp 2
  • German Shepard 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time17.43 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAAACCACTTAGAATCCACCTCATCAAGCCCC
C
C
A
A
A
C
C
A
C
T
T
A
G
A
A
T
C
C
A
C
C
T
C
A
T
C
A
A
G
C
C
C
C
Genes: 5GHF2NK77OL

Composition

German Shepard
18%
Labrador
9%
Boxer
9%
Rottweiler
9%
Yorkshire Terrier
9%
Pug
9%
Pitbull terrier
9%
Maltese
9%
Corgi
9%
Grey Wolf
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Rottweiler
Front Legs Yorkshire Terrier
Head Pug
Ears Pitbull terrier
Snout Maltese
Mouth German Shepard
Nose German Shepard
Eyes Corgi
Color Grey Wolf

Parents

No Children

Photos

online doggy race online doggy race Litecoin pet racing photo virtual doggy race Litecoin doggy race cryptocurrency pet race virtual doggy race photo crypto canine race results