Bagheera Brooke Digital Cryptocurrency Game Dog - Mix of German Shepard, Rottweiler, Labrador, Poodle, Shiba Inu, Corgi and Maltese

Achievements

None
Bagheera Brooke
My favorite place in the world is the dog park. So many smells! I've been known to run with bad dogs. I love cuddling up, doggy-style after a romantic evening. You know the worst? Watching my humans 'get it on' and I have to lick myself.
  • Purity 8%
  • Age 10 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 6
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACACCACCCAGACTCAGTACCAAGCGACACC
T
C
A
C
A
C
C
A
C
C
C
A
G
A
C
T
C
A
G
T
A
C
C
A
A
G
C
G
A
C
A
C
C
Genes: 7HH5I7E5OIK

Composition

German Shepard
18%
Rottweiler
18%
Labrador
18%
Poodle
18%
Shiba Inu
9%
Corgi
9%
Maltese
9%

Current Energy

Vitality -27 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Poodle
Ears German Shepard
Snout Shiba Inu
Mouth Labrador
Nose Corgi
Eyes Poodle
Color Maltese