Bagheera Brooke

My favorite place in the world is the dog park. So many smells! I've been known to run with bad dogs. I love cuddling up, doggy-style after a romantic evening. You know the worst? Watching my humans 'get it on' and I have to lick myself.

Purity 8%
Age 10 months
Racing Exp 0

German Shepard 18%
0 races
Gen 6

Depressed & Snaillike

Energy: ▂▃▅▆▇

Racing Stats


0 races \| 0 0 0	Best Time	--
No rank	Racing	*** Coins
0.0 % wins (0)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: TCACACCACCCAGACTCAGTACCAAGCGACACC

Genes: 7HH5I7E5OIK

Composition

German Shepard	18%
Rottweiler	18%
Labrador	18%
Poodle	18%
Shiba Inu	9%
Corgi	9%
Maltese	9%

Current Energy

Vitality	-27 points
Lunar Effect	+6 points

Traits Breakdown

Body	German Shepard
Tail	Rottweiler
Legs	Rottweiler
Front Legs	Labrador
Head	Poodle
Ears	German Shepard
Snout	Shiba Inu
Mouth	Labrador
Nose	Corgi
Eyes	Poodle
Color	Maltese