Bungee Bit Bitcoin Dog - Mix of Pug, German Shepard, Schnauzer, Boxer, Beagle, Border Collie, Poodle, Pitbull terrier, Golder Retriever and St. Bernard

Achievements

None
Bungee Bit
I love unconditionally. I believe running along the beach to catch a stick can be nearly orgasmic. I slept with a cat and I liked it. I hate it when I am not the center of attention.
  • Purity 3%
  • Age 41 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAATAAACCTATACGACTCCGAAGAAAGATGA
T
C
A
A
T
A
A
A
C
C
T
A
T
A
C
G
A
C
T
C
C
G
A
A
G
A
A
A
G
A
T
G
A
Genes: 7CGDJIN228B

Composition

Pug
18%
German Shepard
9%
Schnauzer
9%
Boxer
9%
Beagle
9%
Border Collie
9%
Poodle
9%
Pitbull terrier
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -25 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Schnauzer
Legs Boxer
Front Legs Beagle
Head Border Collie
Ears Poodle
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Golder Retriever
Color St. Bernard