Bungee Bit Bitcoin Dog - Mix of Pug, German Shepard, Schnauzer, Boxer, Beagle, Border Collie, Poodle, Pitbull terrier, Golder Retriever and St. Bernard
Bungee Bit
  • Purity 3%
  • Age 72 months
  • Racing Exp 52
  • Pug 18%
  • Gold medal 4 Silver medal 1 Bronze medal 1
  • 13 races
  • Gen 0
Ecstatic & Fast

Achievements

Pro Racer
Podium Champion

Bio

I love unconditionally. I believe running along the beach to catch a stick can be nearly orgasmic. I slept with a cat and I liked it. I hate it when I am not the center of attention.

Racing Stats

Ran 13 races
  • 4 1 1
 Best Time15.93 sec
No rank  RacingĀ *** Pts
46.2% wins (6) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAATAAACCTATACGACTCCGAAGAAAGATGA
T
C
A
A
T
A
A
A
C
C
T
A
T
A
C
G
A
C
T
C
C
G
A
A
G
A
A
A
G
A
T
G
A
Genes: 7CGDJIN228B

Composition

Pug
18%
German Shepard
9%
Schnauzer
9%
Boxer
9%
Beagle
9%
Border Collie
9%
Poodle
9%
Pitbull terrier
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -25 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Schnauzer
Legs Boxer
Front Legs Beagle
Head Border Collie
Ears Poodle
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Golder Retriever
Color St. Bernard

Parents

No Children

Photos

online doggy racing results cryptocurrency dog racing Bitcoin dog race online canine racing crypto pet race Litecoin dog race podium virtual dog race photo online canine race podium
Gift