Bungee Bit Bitcoin Dog - Mix of Pug, German Shepard, Schnauzer, Boxer, Beagle, Border Collie, Poodle, Pitbull terrier, Golder Retriever and St. Bernard

Achievements

Pro Racer
Podium Champion
Bungee Bit
I love unconditionally. I believe running along the beach to catch a stick can be nearly orgasmic. I slept with a cat and I liked it. I hate it when I am not the center of attention.
  • Purity 3%
  • Age 39 months
  • Racing Exp 52
  • Pug 18%
  • 13 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

13 races   |
  • 4 1 1
 Best Time15.93 sec
No rank  Racing *** Pts
46.2 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAATAAACCTATACGACTCCGAAGAAAGATGA
T
C
A
A
T
A
A
A
C
C
T
A
T
A
C
G
A
C
T
C
C
G
A
A
G
A
A
A
G
A
T
G
A
Genes: 7CGDJIN228B

Composition

Pug
18%
German Shepard
9%
Schnauzer
9%
Boxer
9%
Beagle
9%
Border Collie
9%
Poodle
9%
Pitbull terrier
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -25 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Schnauzer
Legs Boxer
Front Legs Beagle
Head Border Collie
Ears Poodle
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Golder Retriever
Color St. Bernard

Parents

No Children

Photos

Litecoin doggy race photo online dog race podium virtual dog racing cryptocurrency dog racing podium crypto canine race photo cryptocurrency dog race virtual pet racing Litecoin doggy race photo