Offsides Onyx Bitcoin Game Dog - Mix of St. Bernard, Labrador, Yorkshire Terrier, Corgi, Husky, Poodle, Rottweiler and Boxer

Achievements

None
Offsides Onyx
How goes it? I'm Offsides Onyx. I'm having some new data architecture built for me, then I'd like to have you over to my place. I like shaking my fur next to humans right after a good swim! Too much steak gives me the runs! Steak is my absolute favorite, but I prefer to eat chicken for my health.
  • Purity 4%
  • Age 12 months
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAAGCACACCAGACCACTGACCATTAAACTTA
T
G
A
A
G
C
A
C
A
C
C
A
G
A
C
C
A
C
T
G
A
C
C
A
T
T
A
A
A
C
T
T
A
Genes: BO45IHB5FGF

Composition

St. Bernard
18%
Labrador
18%
Yorkshire Terrier
18%
Corgi
9%
Husky
9%
Poodle
9%
Rottweiler
9%
Boxer
9%

Current Energy

Vitality -33 points
Lunar Effect +6 points

Traits Breakdown

Body St. Bernard
Tail Corgi
Legs Husky
Front Legs Labrador
Head Poodle
Ears Rottweiler
Snout St. Bernard
Mouth Labrador
Nose Yorkshire Terrier
Eyes Boxer
Color Yorkshire Terrier