Lassie Lights Out Bitcoin Dog - Mix of Corgi, German Shepard, Yorkshire Terrier, Labrador BK, Beagle, Maltese, Labrador and Pug

Achievements

None
Lassie Lights Out
What's up, dog? I'm Lassie Lights Out! I hate it when my humans fool me with a pill in peanut butter! I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! Those flying monkeys in the Wizard of Oz still scare me! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy!
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 3
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCAGCTTAAGCTCAGCACTAACCCCAGAA
T
C
A
A
G
C
A
G
C
T
T
A
A
G
C
T
C
A
G
C
A
C
T
A
A
C
C
C
C
A
G
A
A
Genes: 7OOFO76DK52

Composition

Corgi
27%
German Shepard
18%
Yorkshire Terrier
9%
Labrador BK
9%
Beagle
9%
Maltese
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -37 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Corgi
Front Legs Yorkshire Terrier
Head Corgi
Ears German Shepard
Snout Labrador BK
Mouth Beagle
Nose Maltese
Eyes Labrador
Color Pug