Muffy Mickey Bitcoin Dog - Mix of Husky, Pug, Labrador, Maltese and Boxer

Achievements

None
Muffy Mickey
My name is Muffy Mickey and I'd really like to sniff you. I hate having to share my food dish... As a designer, I suggest low windows or couch backs next to windows without curtains. Once I caught a seagull, but it scared me so I let it go. I enjoy mixing it up once in a while by visiting different dog parks.
  • Purity 24%
  • Age 55 days
  • Racing Exp 0
  • Husky 45%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACCAACAACAGAAACAACCGAAGAAAACACA
A
C
A
C
C
A
A
C
A
A
C
A
G
A
A
A
C
A
A
C
C
G
A
A
G
A
A
A
A
C
A
C
A
Genes: 454424K22G4

Composition

Husky
45%
Pug
27%
Labrador
9%
Maltese
9%
Boxer
9%

Current Energy

Vitality +15 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Labrador
Legs Husky
Front Legs Husky
Head Pug
Ears Husky
Snout Maltese
Mouth Pug
Nose Pug
Eyes Boxer
Color Husky

Parents

No Children