Gidget Gringo Virtual Crypto Game Dog - Mix of Husky, Corgi, Labrador, Pitbull terrier, Shiba Inu, Pug and Boxer

Achievements

None
Gidget Gringo
I like to work out by digging fresh holes in landscaped yards. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! You scratch my belly and I'll scratch yours ;)
  • Purity 6%
  • Age 52 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGCACACCATCCGTATCCCCAGAAAGCAAC
A
C
A
A
G
C
A
C
A
C
C
A
T
C
C
G
T
A
T
C
C
C
C
A
G
A
A
A
G
C
A
A
C
Genes: 4O45NEN52OG

Composition

Husky
18%
Corgi
18%
Labrador
18%
Pitbull terrier
18%
Shiba Inu
9%
Pug
9%
Boxer
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Corgi
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears Shiba Inu
Snout Pitbull terrier
Mouth Labrador
Nose Pug
Eyes Corgi
Color Boxer