Noah Nico Crypto Dog - Mix of German Shepard, Pitbull terrier, Rottweiler, Shiba Inu, Golder Retriever, Labrador BK and Maltese

Achievements

None
Noah Nico
They call me Noah Nico. What's your name? I am a guard dog for the data warehouse. Removing excess stuffing from pillows is my favorite hobby. Oh, go ahead. Pet me. I know you want to. I enjoy going to the dog park to see all my friends! I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later!
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 3
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCCCACAGATCCTCAGTACACGTAGCAACC
T
C
A
T
C
C
C
A
C
A
G
A
T
C
C
T
C
A
G
T
A
C
A
C
G
T
A
G
C
A
A
C
C
Genes: 7NH8N7EHE6K

Composition

German Shepard
18%
Pitbull terrier
18%
Rottweiler
18%
Shiba Inu
18%
Golder Retriever
9%
Labrador BK
9%
Maltese
9%

Current Energy

Vitality +4 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Pitbull terrier
Legs Rottweiler
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Shiba Inu
Mouth Rottweiler
Nose Shiba Inu
Eyes Labrador BK
Color Maltese