Cassie Cage Czar Bitcoin Game Dog - Mix of Husky, Boxer, Corgi, Yorkshire Terrier, Golder Retriever, German Shepard and Beagle

Achievements

None
Cassie Cage Czar
Well hello, beautiful. My name's Cassie Cage Czar. I love cuddling up, doggy-style after a romantic evening. I hate being left alone all day. I am not above stealing food off humans' plates. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 12%
  • Age 55 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 13
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGCTTAACAAGAACAAACTCACTAAACACA
A
C
A
A
G
C
T
T
A
A
C
A
A
G
A
A
C
A
A
A
C
T
C
A
C
T
A
A
A
C
A
C
A
Genes: 4OF484G7DG4

Composition

Husky
36%
Boxer
18%
Corgi
9%
Yorkshire Terrier
9%
Golder Retriever
9%
German Shepard
9%
Beagle
9%

Current Energy

Vitality +7 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Corgi
Legs Yorkshire Terrier
Front Legs Husky
Head Golder Retriever
Ears Husky
Snout Boxer
Mouth German Shepard
Nose Beagle
Eyes Boxer
Color Husky