Sherman Sophie Cryptocurrency Game Dog - Mix of Husky, Corgi, Labrador, Pitbull terrier, Shiba Inu, Rottweiler, Pug and St. Bernard

Achievements

None
Sherman Sophie
Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. Squeaky toys are the best, don't you agree? I really enjoy heavy petting. I cry whenever I hear an ambulance siren! I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 4%
  • Age 52 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGCACACCATCCGTACACCCAGAAAGCTGA
A
C
A
A
G
C
A
C
A
C
C
A
T
C
C
G
T
A
C
A
C
C
C
A
G
A
A
A
G
C
T
G
A
Genes: 4O45NEH52OB

Composition

Husky
18%
Corgi
18%
Labrador
18%
Pitbull terrier
9%
Shiba Inu
9%
Rottweiler
9%
Pug
9%
St. Bernard
9%

Current Energy

Vitality +25 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Corgi
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears Shiba Inu
Snout Rottweiler
Mouth Labrador
Nose Pug
Eyes Corgi
Color St. Bernard