Jazmie Jake Litecoin Game Dog - Mix of German Shepard, Shiba Inu, Poodle, Husky, Golder Retriever, Pitbull terrier, Pug, Boxer and Border Collie

Achievements

None
Jazmie Jake
I'm Jazmie Jake. What do they call you? I like big butts, I cannot lie. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? My 'G' spot is under my chin...scratch me there and I'll growl softly.
  • Purity 3%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGACACAAGATCCTCAGTAGAAGTAAACTAC
T
C
A
G
A
C
A
C
A
A
G
A
T
C
C
T
C
A
G
T
A
G
A
A
G
T
A
A
A
C
T
A
C
Genes: 7I48N7E2EGJ

Composition

German Shepard
18%
Shiba Inu
18%
Poodle
9%
Husky
9%
Golder Retriever
9%
Pitbull terrier
9%
Pug
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality +9 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Shiba Inu
Mouth Pug
Nose Shiba Inu
Eyes Boxer
Color Border Collie