Cookie Clinic Bitcoin Game Dog - Mix of Corgi, German Shepard, Yorkshire Terrier, Golder Retriever, Border Collie, French Bulldog, St. Bernard and Rottweiler

Achievements

None
Cookie Clinic
Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I've always wanted to be in commercials and be treated as the star I am! I don't like having to stay in the car when my people go inside.
  • Purity 11%
  • Age 52 days
  • Racing Exp 0
  • Corgi 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATTAAGAAGCTACCGAAGCTGACACAGCAGC
T
C
A
T
T
A
A
G
A
A
G
C
T
A
C
C
G
A
A
G
C
T
G
A
C
A
C
A
G
C
A
G
C
Genes: 7F8OJ9OBHOO

Composition

Corgi
36%
German Shepard
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Border Collie
9%
French Bulldog
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality +17 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Yorkshire Terrier
Legs Golder Retriever
Front Legs Corgi
Head Border Collie
Ears French Bulldog
Snout Corgi
Mouth St. Bernard
Nose Rottweiler
Eyes Corgi
Color Corgi