Cogsworth Cassie Litecoin Game Dog - Mix of Maltese, Shiba Inu, Husky, Border Collie, Golder Retriever, Schnauzer and Poodle

Achievements

None
Cogsworth Cassie
I'm a super-dog in the internet universe. I adore sleeping upside down with my tongue hanging out! I enjoy staying active, and running circles around puppies and young children. Removing excess stuffing from pillows is my favorite hobby. I hate going to the vet and will do almost anything to avoid it.
  • Purity 6%
  • Age 52 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCGTAACCACAAGAACAATATACGACTACGTA
A
C
C
G
T
A
A
C
C
A
C
A
A
G
A
A
C
A
A
T
A
T
A
C
G
A
C
T
A
C
G
T
A
Genes: KEK484CJIJE

Composition

Maltese
18%
Shiba Inu
18%
Husky
18%
Border Collie
18%
Golder Retriever
9%
Schnauzer
9%
Poodle
9%

Current Energy

Vitality -15 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail Shiba Inu
Legs Maltese
Front Legs Husky
Head Golder Retriever
Ears Husky
Snout Schnauzer
Mouth Border Collie
Nose Poodle
Eyes Border Collie
Color Shiba Inu