Jackpot Juno Litecoin Dog - Mix of German Shepard, Shiba Inu, Pug, Corgi, Golder Retriever, Pitbull terrier, Maltese, Labrador BK and French Bulldog

Achievements

None
Jackpot Juno
I'm Jackpot Juno. How goes it? I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I pee when I'm excited. I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 3%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAAGCAGATCCTCAGTAACCGTAGCACGA
T
C
A
G
A
A
A
G
C
A
G
A
T
C
C
T
C
A
G
T
A
A
C
C
G
T
A
G
C
A
C
G
A
Genes: 72O8N7EKE69

Composition

German Shepard
18%
Shiba Inu
18%
Pug
9%
Corgi
9%
Golder Retriever
9%
Pitbull terrier
9%
Maltese
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality +7 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Corgi
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Shiba Inu
Mouth Maltese
Nose Shiba Inu
Eyes Labrador BK
Color French Bulldog