Agent 47 Ash Digital Cryptocurrency Dog - Mix of Husky, Pitbull terrier, Border Collie, Shiba Inu, Beagle and Boxer

Achievements

None
Agent 47 Ash
You can call me Agent 47 Ash, everybody else does. I never knew my father. You know the worst? Watching my humans 'get it on' and I have to lick myself. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 13%
  • Age 55 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAACAACATCCACATCCTACCTAAACTAC
A
C
A
G
T
A
A
C
A
A
C
A
T
C
C
A
C
A
T
C
C
T
A
C
C
T
A
A
A
C
T
A
C
Genes: 4E44N4NJDGJ

Composition

Husky
36%
Pitbull terrier
18%
Border Collie
18%
Shiba Inu
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality +15 points
Lunar Effect +10 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Pitbull terrier
Mouth Border Collie
Nose Beagle
Eyes Boxer
Color Border Collie