Wolfgang Whiskers Litecoin Dog - Mix of Husky, Border Collie, Pug, Labrador, Rottweiler, Beagle, Golder Retriever and Boxer

Achievements

None
Wolfgang Whiskers
I live life by my favorite quote "Every dog has it's day", but every day is my day! I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I hate it when humans put the lid down. I have a crush on the Grumpy cat.
  • Purity 4%
  • Age 52 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATACCCAACACACGAATACCTAAGAGAAAAC
A
C
A
T
A
C
C
C
A
A
C
A
C
A
C
G
A
A
T
A
C
C
T
A
A
G
A
G
A
A
A
A
C
Genes: 4J54H2JD82G

Composition

Husky
18%
Border Collie
18%
Pug
18%
Labrador
9%
Rottweiler
9%
Beagle
9%
Golder Retriever
9%
Boxer
9%

Current Energy

Vitality +30 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Border Collie
Legs Labrador
Front Legs Husky
Head Rottweiler
Ears Pug
Snout Border Collie
Mouth Beagle
Nose Golder Retriever
Eyes Pug
Color Boxer