Cisco Cobra Virtual Crypto Game Dog - Mix of Border Collie, St. Bernard, Yorkshire Terrier, Pitbull terrier, Boxer, Labrador BK and Schnauzer

Achievements

None
Cisco Cobra
Let me introduce myself, I'm Cisco Cobra. I enjoy destroying a nice fresh pair of slippers. If you enjoy growling through fences as much as I do, we should get together. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 7%
  • Age 55 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTGATACTCCTACTTAAACGCATGATTAATA
T
A
C
T
G
A
T
A
C
T
C
C
T
A
C
T
T
A
A
A
C
G
C
A
T
G
A
T
T
A
A
T
A
Genes: JBJNJFG6BFC

Composition

Border Collie
27%
St. Bernard
18%
Yorkshire Terrier
18%
Pitbull terrier
9%
Boxer
9%
Labrador BK
9%
Schnauzer
9%

Current Energy

Vitality +21 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Border Collie
Front Legs Pitbull terrier
Head Border Collie
Ears Yorkshire Terrier
Snout Boxer
Mouth Labrador BK
Nose St. Bernard
Eyes Yorkshire Terrier
Color Schnauzer

Parents

No Children