Teddy Tesla Digital Cryptocurrency Dog - Mix of Maltese, Yorkshire Terrier, St. Bernard, Labrador BK, Dachshund, Corgi, Poodle and Border Collie

Achievements

None
Teddy Tesla
I work in The Virtual Machine. I'm not a fan of sleeping on the floor. This body was made for cuddles! Air Bud is definitely my favorite movie. What a role model! I like big butts, I cannot lie. Those flying monkeys in the Wizard of Oz still scare me!
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCTTAACCGCAGGAAGCTGATGAGACTACTTA
A
C
C
T
T
A
A
C
C
G
C
A
G
G
A
A
G
C
T
G
A
T
G
A
G
A
C
T
A
C
T
T
A
Genes: KFK6AOBBIJF

Composition

Maltese
18%
Yorkshire Terrier
18%
St. Bernard
18%
Labrador BK
9%
Dachshund
9%
Corgi
9%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -8 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Yorkshire Terrier
Legs Maltese
Front Legs Labrador BK
Head Dachshund
Ears Corgi
Snout St. Bernard
Mouth St. Bernard
Nose Poodle
Eyes Border Collie
Color Yorkshire Terrier