Mitch Magic Crypto Dog - Mix of Border Collie, St. Bernard, Yorkshire Terrier, Pitbull terrier, Labrador BK, Husky and Pug

Achievements

None
Mitch Magic
Howdy! I'm Mitch Magic. I live inside of a web app in a big data center. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 9%
  • Age 55 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTGATACTCCTACTTATTAGCATGAACAGAA
T
A
C
T
G
A
T
A
C
T
C
C
T
A
C
T
T
A
T
T
A
G
C
A
T
G
A
A
C
A
G
A
A
Genes: JBJNJFF6B42

Composition

Border Collie
27%
St. Bernard
18%
Yorkshire Terrier
18%
Pitbull terrier
9%
Labrador BK
9%
Husky
9%
Pug
9%

Current Energy

Vitality +26 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Border Collie
Front Legs Pitbull terrier
Head Border Collie
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Labrador BK
Nose St. Bernard
Eyes Husky
Color Pug

Parents

No Children