Raison Raiden Digital Cryptocurrency Game Dog - Mix of Pug, Labrador BK, Golder Retriever, German Shepard, Husky, Corgi, Rottweiler and Shiba Inu

Achievements

None
Raison Raiden
If you have fleas or ticks, don't bother. Squeaky toys are the best, don't you agree? I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. It turns me on when I can show an older dog a new trick.
  • Purity 8%
  • Age 52 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGATCAGAAACAGCAGAAGAAAGCCACGTA
G
C
A
A
G
A
T
C
A
G
A
A
A
C
A
G
C
A
G
A
A
G
A
A
A
G
C
C
A
C
G
T
A
Genes: 68724622OHE

Composition

Pug
27%
Labrador BK
18%
Golder Retriever
9%
German Shepard
9%
Husky
9%
Corgi
9%
Rottweiler
9%
Shiba Inu
9%

Current Energy

Vitality +13 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs German Shepard
Front Legs Pug
Head Husky
Ears Labrador BK
Snout Pug
Mouth Pug
Nose Corgi
Eyes Rottweiler
Color Shiba Inu