Lakin Lady Crypto Game Dog - Mix of Grey Wolf, Dachshund, Husky, Poodle, Corgi, French Bulldog, Pitbull terrier, Golder Retriever, Yorkshire Terrier and Labrador BK

Achievements

Racer
Lakin Lady
Lakin Lady here. Wanna play? I hate not being allowed to hunt treasure in the garbage. It smells so good! I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I'm willing to try little bondage, so my human chained me up! My idea of romance would be to stroll through in the dog park then share a meaty bone with you.
  • Purity 1%
  • Age 39 months
  • Racing Exp 2
  • Grey Wolf 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time17.33 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAACAGACCCCAGCCGATCCCCCAGATTAGCA
G
G
A
A
C
A
G
A
C
C
C
C
A
G
C
C
G
A
T
C
C
C
C
C
A
G
A
T
T
A
G
C
A
Genes: A4ILO9NL8F6

Composition

Grey Wolf
18%
Dachshund
9%
Husky
9%
Poodle
9%
Corgi
9%
French Bulldog
9%
Pitbull terrier
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Labrador BK
9%

Current Energy

Vitality -41 points
Lunar Effect -10 points

Traits Breakdown

Body Dachshund
Tail Husky
Legs Poodle
Front Legs Grey Wolf
Head Corgi
Ears French Bulldog
Snout Pitbull terrier
Mouth Grey Wolf
Nose Golder Retriever
Eyes Yorkshire Terrier
Color Labrador BK