Rayman Reese Litecoin Dog - Mix of Beagle, Husky, Labrador BK, Shiba Inu, Corgi, St. Bernard, Dachshund and Rottweiler

Achievements

None
Rayman Reese
Hey, good-looking! This is Rayman Reese. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I may need de-worming. I hate not being allowed to hunt treasure in the garbage. It smells so good! I enjoy destroying a nice fresh pair of slippers.
  • Purity 8%
  • Age 52 days
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGTAAGCACACTAACATGAGGACTACTACAC
G
C
A
G
T
A
A
G
C
A
C
A
C
T
A
A
C
A
T
G
A
G
G
A
C
T
A
C
T
A
C
A
C
Genes: 6EO4D4BADDH

Composition

Beagle
27%
Husky
18%
Labrador BK
9%
Shiba Inu
9%
Corgi
9%
St. Bernard
9%
Dachshund
9%
Rottweiler
9%

Current Energy

Vitality +10 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Corgi
Front Legs Husky
Head Beagle
Ears Husky
Snout St. Bernard
Mouth Dachshund
Nose Beagle
Eyes Beagle
Color Rottweiler

Parents

No Children