Deanna Danger Crypto Game Dog - Mix of Husky, German Shepard, Golder Retriever, Border Collie, Grey Wolf and Beagle

Achievements

None
Deanna Danger
Nice to meet you! I'm Deanna Danger. I work in The Virtual Machine. Spiked dog collars really turn me on. I like giving wet kisses. I hate being left alone all day. The place I like most in the world is curled up in my human's bed, hogging all the covers!
  • Purity 13%
  • Age 52 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACAAGAACATCAACATACCCCCTATCAACA
T
C
A
A
C
A
A
G
A
A
C
A
T
C
A
A
C
A
T
A
C
C
C
C
C
T
A
T
C
A
A
C
A
Genes: 748474JLD74

Composition

Husky
36%
German Shepard
27%
Golder Retriever
9%
Border Collie
9%
Grey Wolf
9%
Beagle
9%

Current Energy

Vitality +25 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Golder Retriever
Front Legs Husky
Head German Shepard
Ears Husky
Snout Border Collie
Mouth Grey Wolf
Nose Beagle
Eyes German Shepard
Color Husky