Gypsy Gray Fox Bitcoin Dog - Mix of Border Collie, French Bulldog, Labrador, Beagle, Poodle, Schnauzer, Shiba Inu and Rottweiler

Achievements

None
Gypsy Gray Fox
Hey there! Baby, call me Gypsy Gray Fox. My humans should try spending 8 hours a day in a crate! Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Spiked dog collars really turn me on. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate!
  • Purity 4%
  • Age 55 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATACGACATACGACCAGTACCACACTACCGA
C
T
A
T
A
C
G
A
C
A
T
A
C
G
A
C
C
A
G
T
A
C
C
A
C
A
C
T
A
C
C
G
A
Genes: DJIC95E5HJ9

Composition

Border Collie
18%
French Bulldog
18%
Labrador
18%
Beagle
9%
Poodle
9%
Schnauzer
9%
Shiba Inu
9%
Rottweiler
9%

Current Energy

Vitality -7 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Poodle
Front Legs Schnauzer
Head French Bulldog
Ears Labrador
Snout Shiba Inu
Mouth Labrador
Nose Rottweiler
Eyes Border Collie
Color French Bulldog

Parents

No Children