Fiona Flash Crypto Dog - Mix of Husky, German Shepard, Border Collie, Corgi and Beagle

Achievements

None
Fiona Flash
They call me Fiona Flash. What's your name? My 'G' spot is under my chin...scratch me there and I'll growl softly. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please.
  • Purity 16%
  • Age 52 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACAAGCACATCAACATACTACCTATCAACA
T
C
A
A
C
A
A
G
C
A
C
A
T
C
A
A
C
A
T
A
C
T
A
C
C
T
A
T
C
A
A
C
A
Genes: 74O474JJD74

Composition

Husky
36%
German Shepard
27%
Border Collie
18%
Corgi
9%
Beagle
9%

Current Energy

Vitality +17 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Corgi
Front Legs Husky
Head German Shepard
Ears Husky
Snout Border Collie
Mouth Border Collie
Nose Beagle
Eyes German Shepard
Color Husky