Kimmy Kipling Bitcoin Dog - Mix of Labrador BK, Border Collie, German Shepard, Pug, Maltese, Dachshund, St. Bernard, Rottweiler and Pitbull terrier

Achievements

None
Kimmy Kipling
When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I enjoy mixing it up once in a while by visiting different dog parks. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I just want to share a ball with someone, if you know what I mean...
  • Purity 5%
  • Age 55 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAACCGCAGCATACGGATGACACTACTCC
T
C
A
G
A
A
A
C
C
G
C
A
G
C
A
T
A
C
G
G
A
T
G
A
C
A
C
T
A
C
T
C
C
Genes: 72K66JABHJN

Composition

Labrador BK
18%
Border Collie
18%
German Shepard
9%
Pug
9%
Maltese
9%
Dachshund
9%
St. Bernard
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality +6 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Maltese
Front Legs Labrador BK
Head Labrador BK
Ears Border Collie
Snout Dachshund
Mouth St. Bernard
Nose Rottweiler
Eyes Border Collie
Color Pitbull terrier