Squat Sticks Litecoin Game Dog - Mix of Pug, Husky, Border Collie, Shiba Inu, Poodle, St. Bernard and Rottweiler

Achievements

None
Squat Sticks
Creativity is my middle name... I turn everything in to a chew toy. If you enjoy growling through fences as much as I do, we should get together. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I'm not that picky. Wanna mate?
  • Purity 10%
  • Age 52 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAAGTAACAGAAACAGAAGACGAATGACAC
T
A
C
G
A
A
G
T
A
A
C
A
G
A
A
A
C
A
G
A
A
G
A
C
G
A
A
T
G
A
C
A
C
Genes: J2E4242I2BH

Composition

Pug
36%
Husky
18%
Border Collie
9%
Shiba Inu
9%
Poodle
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality +9 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Shiba Inu
Front Legs Husky
Head Pug
Ears Husky
Snout Pug
Mouth Poodle
Nose Pug
Eyes St. Bernard
Color Rottweiler

Parents

No Children