Ninja Ninja Digital Cryptocurrency Dog - Mix of German Shepard, Rottweiler, Dachshund, Border Collie, Labrador, Maltese, Boxer, Yorkshire Terrier, Corgi and Pitbull terrier

Achievements

None
Ninja Ninja
Salutations! My name's Ninja Ninja. Size matters. This dawg's into big databases. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. You know the worst? Watching my humans 'get it on' when I've got no one. Too much steak gives me the runs!
  • Purity 1%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGGATACCCAACCAACTCATTAAGCTCCTCA
C
A
C
G
G
A
T
A
C
C
C
A
A
C
C
A
A
C
T
C
A
T
T
A
A
G
C
T
C
C
T
C
A
Genes: HAJ5KG7FON7

Composition

German Shepard
18%
Rottweiler
9%
Dachshund
9%
Border Collie
9%
Labrador
9%
Maltese
9%
Boxer
9%
Yorkshire Terrier
9%
Corgi
9%
Pitbull terrier
9%

Current Energy

Vitality +17 points
Lunar Effect -6 points

Traits Breakdown

Body Rottweiler
Tail Dachshund
Legs Border Collie
Front Legs Labrador
Head Maltese
Ears Boxer
Snout German Shepard
Mouth Yorkshire Terrier
Nose Corgi
Eyes Pitbull terrier
Color German Shepard