Geppetto Ghost Litecoin Game Dog - Mix of German Shepard, Rottweiler, Dachshund, Border Collie, Labrador, Maltese, Boxer, Yorkshire Terrier, Corgi and Pitbull terrier

Achievements

Racer
Geppetto Ghost
I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! It turns me on when I can show an older dog a new trick. Steak is my absolute favorite, but I prefer to eat chicken for my health. I just want to share a ball with someone, if you know what I mean...
  • Purity 1%
  • Age 55 days
  • Racing Exp 1
  • German Shepard 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.03 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGGATACCCAACCAACTCATTAAGCTCCTCA
C
A
C
G
G
A
T
A
C
C
C
A
A
C
C
A
A
C
T
C
A
T
T
A
A
G
C
T
C
C
T
C
A
Genes: HAJ5KG7FON7

Composition

German Shepard
18%
Rottweiler
9%
Dachshund
9%
Border Collie
9%
Labrador
9%
Maltese
9%
Boxer
9%
Yorkshire Terrier
9%
Corgi
9%
Pitbull terrier
9%

Current Energy

Vitality +17 points
Lunar Effect -6 points

Traits Breakdown

Body Rottweiler
Tail Dachshund
Legs Border Collie
Front Legs Labrador
Head Maltese
Ears Boxer
Snout German Shepard
Mouth Yorkshire Terrier
Nose Corgi
Eyes Pitbull terrier
Color German Shepard