Ryder Rico Digital Cryptocurrency Game Dog - Mix of French Bulldog, Golder Retriever, Dachshund, Husky, Labrador, Border Collie, Pitbull terrier, St. Bernard and Rottweiler

Achievements

None
Ryder Rico
Hello, I be Ryder Rico. The internet's my home. I absolutely love long walks when I can stop and smell the bushes. I'm an avid runner! Outside, inside, all over the place! I just want to run! If you have fleas or ticks, don't bother. Too much steak gives me the runs!
  • Purity 3%
  • Age 56 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAGGAAGAACACGAAGACCATACTCCTGACAC
C
G
A
G
G
A
A
G
A
A
C
A
C
G
A
A
G
A
C
C
A
T
A
C
T
C
C
T
G
A
C
A
C
Genes: 9A84985JNBH

Composition

French Bulldog
18%
Golder Retriever
18%
Dachshund
9%
Husky
9%
Labrador
9%
Border Collie
9%
Pitbull terrier
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality +7 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail Dachshund
Legs Golder Retriever
Front Legs Husky
Head French Bulldog
Ears Golder Retriever
Snout Labrador
Mouth Border Collie
Nose Pitbull terrier
Eyes St. Bernard
Color Rottweiler