Pockets Petunia Litecoin Game Dog - Mix of Corgi, Dachshund, Beagle, Pug, Maltese and Yorkshire Terrier

Achievements

None
Pockets Petunia
Yo dog! Pockets Petunia here. I hate going to the vet and will do almost anything to avoid it. Once I caught a seagull, but it scared me so I let it go. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I want to find a mate who enjoys dog parks as much as I do.
  • Purity 13%
  • Age 56 days
  • Racing Exp 0
  • Corgi 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGAAAGCACCAGCTTAAGCGGACTACTAAGC
G
G
A
G
A
A
A
G
C
A
C
C
A
G
C
T
T
A
A
G
C
G
G
A
C
T
A
C
T
A
A
G
C
Genes: A2OKOFOADDO

Composition

Corgi
36%
Dachshund
18%
Beagle
18%
Pug
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -18 points
Lunar Effect +6 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Corgi
Front Legs Maltese
Head Corgi
Ears Yorkshire Terrier
Snout Corgi
Mouth Dachshund
Nose Beagle
Eyes Beagle
Color Corgi