Silver Southpaw Digital Cryptocurrency Dog - Mix of Pug, St. Bernard, Shiba Inu, Beagle, Border Collie, Poodle and Pitbull terrier

Achievements

None
Silver Southpaw
I work in The Virtual Machine. When I hook up, I stay hooked up for about 20 minutes. I hate having to wear foo-foo clothes and ribbons in my fur. Chasing anything that will run is so much fun, I could do that all day. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks...
  • Purity 14%
  • Age 53 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGTATGACTATACGACTCCGAAGAAGAATGA
G
A
A
G
T
A
T
G
A
C
T
A
T
A
C
G
A
C
T
C
C
G
A
A
G
A
A
G
A
A
T
G
A
Genes: 2EBDJIN222B

Composition

Pug
36%
St. Bernard
18%
Shiba Inu
9%
Beagle
9%
Border Collie
9%
Poodle
9%
Pitbull terrier
9%

Current Energy

Vitality -6 points
Lunar Effect +2 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs St. Bernard
Front Legs Beagle
Head Border Collie
Ears Poodle
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Pug
Color St. Bernard