Marky Mark Miley Litecoin Dog - Mix of St. Bernard, Rottweiler, Border Collie, Schnauzer, Maltese, Boxer and Yorkshire Terrier

Achievements

None
Marky Mark Miley
Suh...you good? Marky Mark Miley here. Here in cyberspace, I ain't got much use for a floppy disc. I'm going kill that damn Nyan Cat if I can catch it. I hate it when humans put the lid down. Getting out of a long relationship, not looking for another
  • Purity 9%
  • Age 56 days
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGACACATATGAACCAACTTATACTACTGA
C
A
C
T
G
A
C
A
C
A
T
A
T
G
A
A
C
C
A
A
C
T
T
A
T
A
C
T
A
C
T
G
A
Genes: HBHCBKGFJJB

Composition

St. Bernard
27%
Rottweiler
18%
Border Collie
18%
Schnauzer
9%
Maltese
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality +1 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Rottweiler
Front Legs Schnauzer
Head St. Bernard
Ears Maltese
Snout Boxer
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Border Collie
Color St. Bernard