Tootsie Tony Bitcoin Dog - Mix of Corgi, Schnauzer, French Bulldog, Golder Retriever, Labrador, Beagle, Maltese and Labrador BK
Tootsie Tony
  • Purity 8%
  • Age 37 months
  • Racing Exp 2
  • Corgi 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

It's a barkin' beautiful day! Tootsie Tony here. I'm all about a hard drive because you can't do anything with a floppy disc. My favorite chews are underwear and rawhide...the rawhide lasts longer. I've been known to run with bad dogs. I hate it when my humans fart and they blame me!

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time17.33 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CGAAGCATAAGAATAAGCAGCCCACTAACCGCA
C
G
A
A
G
C
A
T
A
A
G
A
A
T
A
A
G
C
A
G
C
C
C
A
C
T
A
A
C
C
G
C
A
Genes: 9OC8COO5DK6

Composition

Corgi
27%
Schnauzer
18%
French Bulldog
9%
Golder Retriever
9%
Labrador
9%
Beagle
9%
Maltese
9%
Labrador BK
9%

Current Energy

Vitality -47 points
Lunar Effect -2 points

Traits Breakdown

Body French Bulldog
Tail Corgi
Legs Schnauzer
Front Legs Golder Retriever
Head Schnauzer
Ears Corgi
Snout Corgi
Mouth Labrador
Nose Beagle
Eyes Maltese
Color Labrador BK

Parents

No Children

Photos

virtual doggy racing photo crypto doggy race podium online doggy race cryptocurrency pet racing podium
Gift