Tootsie Tony Bitcoin Dog - Mix of Corgi, Schnauzer, French Bulldog, Golder Retriever, Labrador, Beagle, Maltese and Labrador BK

Achievements

None
Tootsie Tony
It's a barkin' beautiful day! Tootsie Tony here. I'm all about a hard drive because you can't do anything with a floppy disc. My favorite chews are underwear and rawhide...the rawhide lasts longer. I've been known to run with bad dogs. I hate it when my humans fart and they blame me!
  • Purity 8%
  • Age 41 months
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAAGCATAAGAATAAGCAGCCCACTAACCGCA
C
G
A
A
G
C
A
T
A
A
G
A
A
T
A
A
G
C
A
G
C
C
C
A
C
T
A
A
C
C
G
C
A
Genes: 9OC8COO5DK6

Composition

Corgi
27%
Schnauzer
18%
French Bulldog
9%
Golder Retriever
9%
Labrador
9%
Beagle
9%
Maltese
9%
Labrador BK
9%

Current Energy

Vitality -47 points
Lunar Effect +2 points

Traits Breakdown

Body French Bulldog
Tail Corgi
Legs Schnauzer
Front Legs Golder Retriever
Head Schnauzer
Ears Corgi
Snout Corgi
Mouth Labrador
Nose Beagle
Eyes Maltese
Color Labrador BK