Motaro Major Bitcoin Dog - Mix of Yorkshire Terrier, Rottweiler, Labrador BK, Poodle, German Shepard, Border Collie and Maltese

Achievements

None
Motaro Major
Good day to you! I'm Motaro Major! I work in The Virtual Machine. I enjoy going to the dog park to see all my friends! My favorite treat is to steal the pepperoni off of pizza. I've had my nose rubbed in 'it' more than once. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another!
  • Purity 16%
  • Age 56 days
  • Racing Exp 0
  • Yorkshire Terrier 45%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTTAGCATTATTAGACTCATTATACACCTTA
C
A
C
T
T
A
G
C
A
T
T
A
T
T
A
G
A
C
T
C
A
T
T
A
T
A
C
A
C
C
T
T
A
Genes: HF6FFI7FJKF

Composition

Yorkshire Terrier
45%
Rottweiler
9%
Labrador BK
9%
Poodle
9%
German Shepard
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality +1 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Yorkshire Terrier
Legs Labrador BK
Front Legs Yorkshire Terrier
Head Yorkshire Terrier
Ears Poodle
Snout German Shepard
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Maltese
Color Yorkshire Terrier