Scrappy Sonya Blade Litecoin Game Dog - Mix of French Bulldog, Pug, Dachshund, Border Collie, Yorkshire Terrier, Husky and Pitbull terrier

Achievements

None
Scrappy Sonya Blade
Hope you like the smell of wet fur, because I'll jump into any water I see! When my human brushes my coat, I get frisky! I hate it when other dogs pee in my yard! IT'S MY YARD!! I like big butts, I cannot lie.
  • Purity 7%
  • Age 56 days
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAGAATACTTAACACGAGGAGAATCCCGAGGA
C
G
A
G
A
A
T
A
C
T
T
A
A
C
A
C
G
A
G
G
A
G
A
A
T
C
C
C
G
A
G
G
A
Genes: 92JF49A2N9A

Composition

French Bulldog
27%
Pug
18%
Dachshund
18%
Border Collie
9%
Yorkshire Terrier
9%
Husky
9%
Pitbull terrier
9%

Current Energy

Vitality +3 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail Pug
Legs Border Collie
Front Legs Yorkshire Terrier
Head Husky
Ears French Bulldog
Snout Dachshund
Mouth Pug
Nose Pitbull terrier
Eyes French Bulldog
Color Dachshund