Persy Pupperino Digital Cryptocurrency Dog - Mix of Corgi, Husky, French Bulldog, Golder Retriever, St. Bernard, Labrador BK and Maltese

Achievements

None
Persy Pupperino
Hi, I'm Persy Pupperino. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm looking to share time together and not just to be an accessory.
  • Purity 12%
  • Age 56 days
  • Racing Exp 0
  • Corgi 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAAGCAGCAGAACATGAAGCGCAACCACAAGC
C
G
A
A
G
C
A
G
C
A
G
A
A
C
A
T
G
A
A
G
C
G
C
A
A
C
C
A
C
A
A
G
C
Genes: 9OO84BO6K4O

Composition

Corgi
36%
Husky
18%
French Bulldog
9%
Golder Retriever
9%
St. Bernard
9%
Labrador BK
9%
Maltese
9%

Current Energy

Vitality +12 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Corgi
Legs Corgi
Front Legs Golder Retriever
Head Husky
Ears St. Bernard
Snout Corgi
Mouth Labrador BK
Nose Maltese
Eyes Husky
Color Corgi