Pasha Pirate Crypto Dog - Mix of French Bulldog, Dachshund, Shiba Inu, Yorkshire Terrier, Maltese, Rottweiler and Boxer

Achievements

None
Pasha Pirate
I love waking up early then indulging in long afternoon naps. I have a crush on the Grumpy cat. I hate having to share my food dish... Eat, sleep, poop. Honey, I've got it made. I've been solitary dog...looking for someone worth changing over.
  • Purity 12%
  • Age 4 months
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTATTACGACGAACCGGACACAACGGAGGACGA
G
T
A
T
T
A
C
G
A
C
G
A
A
C
C
G
G
A
C
A
C
A
A
C
G
G
A
G
G
A
C
G
A
Genes: EF99KAHGAA9

Composition

French Bulldog
27%
Dachshund
27%
Shiba Inu
9%
Yorkshire Terrier
9%
Maltese
9%
Rottweiler
9%
Boxer
9%

Current Energy

Vitality -39 points
Lunar Effect +16 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs French Bulldog
Front Legs French Bulldog
Head Maltese
Ears Dachshund
Snout Rottweiler
Mouth Boxer
Nose Dachshund
Eyes Dachshund
Color French Bulldog

Parents

No Children