Midnight Mamie Litecoin Dog - Mix of Rottweiler, Labrador, Grey Wolf, Yorkshire Terrier and Husky

Achievements

None
Midnight Mamie
How do you do? I'm Midnight Mamie. As a digital dog, let me say Bob Dole did not invent the internet. When I hook up, I stay hooked up for about 20 minutes. The absolute best time of day is dinner time! My bark alone scares birds out of my yard. I don't appreciate being around bores who bark too much.
  • Purity 29%
  • Age 54 days
  • Racing Exp 0
  • Rottweiler 55%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCACCACCCACACCCACACCACCCCTTAACA
C
A
C
C
A
C
C
A
C
C
C
A
C
A
C
C
C
A
C
A
C
C
A
C
C
C
C
T
T
A
A
C
A
Genes: HHH5H5HHLF4

Composition

Rottweiler
55%
Labrador
18%
Grey Wolf
9%
Yorkshire Terrier
9%
Husky
9%

Current Energy

Vitality +15 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Rottweiler
Ears Labrador
Snout Rottweiler
Mouth Rottweiler
Nose Grey Wolf
Eyes Yorkshire Terrier
Color Husky

Parents

No Children