Reggie Ridley Digital Cryptocurrency Dog - Mix of Border Collie and Maltese

Achievements

None
Reggie Ridley
I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I don't like running outta pee when there are still so many trees. Eat, sleep, poop. Honey, I've got it made. Dragging my butt on the carpet feels so good.
  • Purity 82%
  • Age 56 days
  • Racing Exp 0
  • Border Collie 91%
  • 0 races
  • Gen 7
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACTACTACTACTACACCTACTACTACTAC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
A
C
C
T
A
C
T
A
C
T
A
C
T
A
C
Genes: JJJJJJKJJJJ

Composition

Border Collie
91%
Maltese
9%

Current Energy

Vitality +41 points
Lunar Effect +22 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Border Collie
Snout Maltese
Mouth Border Collie
Nose Border Collie
Eyes Border Collie
Color Border Collie

Parents

No Children