Maggie-Moo Muffin Crypto Dog - Mix of French Bulldog, Dachshund, Maltese, Corgi, Pitbull terrier, Border Collie and Labrador BK

Achievements

None
Maggie-Moo Muffin
Baby, I'm made from the same stuff as dreams. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... Fences are just challenges...I don't let them stop me! The place I like most in the world is curled up in my human's bed, hogging all the covers!
  • Purity 10%
  • Age 54 days
  • Racing Exp 0
  • French Bulldog 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAACCAGCCGAGGACGAGGATCCCGATACGCA
C
G
A
A
C
C
A
G
C
C
G
A
G
G
A
C
G
A
G
G
A
T
C
C
C
G
A
T
A
C
G
C
A
Genes: 9KO9A9AN9J6

Composition

French Bulldog
36%
Dachshund
18%
Maltese
9%
Corgi
9%
Pitbull terrier
9%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -6 points
Lunar Effect -12 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs Corgi
Front Legs French Bulldog
Head Dachshund
Ears French Bulldog
Snout Dachshund
Mouth Pitbull terrier
Nose French Bulldog
Eyes Border Collie
Color Labrador BK

Parents

No Children